Learning About, Learning From

There is much to learn about literature. Great works yield data about human cultures, about history, society and politics, about language. The student or scholar can be a dispassionate anthropologist, scientist, or social historian of literature, seeking to acquire new knowledge.

We can also learn from literature, just as we learn from our parents, from past experiences, from those wiser than us. Literary study can encourage new encounters and exchanges that allow us to learn from others.

Learning about and from literature are not, and should not, be opposed stances. Educational settings encourage different emphases, but in such an intensely personal matter, it’s for each of us to choose our outlook on literature and its significance.

(inspired by a piece in memory of Kenneth W. Morgan)


Literature as Seed Bank

I visited the Wellcome Collection last week and browsed through the Code of Life. A wall was filled with shelves of the human genome, mapped and printed as sequences of letters in many volumes for each chromosome. Here’s a tiny extract from Chromosome Six:

TATTTTTTAAAATTGAATTCAATAATATATTAAAAAGGATGATATAACATGATCATAAAA
GTTTATGCCAGGAATGGAAGGCATGTTTAACATGCAAAAAATCAATGTGATTCCACATCT
TAACAGAATACAAAAGAAAAATTATGTAATTATGTAAATGGATGCAGAAAAAGGCATTTG
CTCATTCATGATAAAAAGTCCTAGAAAACTAGGAATAAAAAGGAATTACCTGATAAGGTG
TGTCCATGAAAACCAACAACTGAAATTTTCAATTTTGGGTGGGGGAGGGGGGCGGGCATT
TTACTTTCTCCATAAAACTATTAAATTATCTAATGTGAAAGTGGAATTCAGTGAAGAAAT
GTTCCCTACTGCAAAAATACAAAATGCTGGACATTCTGTGAACAGTTTCTATGCATTCTA
TATAAATGAAACTATTAACTATATAATACATTTATTGAAAAAAGAAGATGGCCTTCTTTT

Together the letters correspond to an individual human being, and no two people have the same sequences of letters (unless you’re identical twins?–I hope my novice biological knowledge is holding up here).It’s important for the human species that the population retains the widest possible body of genes to encourage variation and adaptation so that the species stays strong. We need a large gene pool.

Gene pools are connected to our idea of liberty. John Stuart Mill’s classic treatise On Liberty was published in 1859, the same year as Charles Darwin’s Origin of Species. Mill ‘insists on freedom of thought as the only effective means for keeping the gene pool of ideas well-stocked and ready to generate valuable original notions that can improve the general sum of happiness’ (see the article by Scott Rosenberg that this quotation comes from for more). Liberty allows societies to keep healthy in future generations, and not succumb to the intellectual incest of authoritarian regimes, censorship or other forms of ideological control.

One aspect of liberty is to keep our gene pool of ideas splashy by allowing lots of different languages, words and phrases to co-exist. There isn’t a single Book of Knowledge (no, not even Wikipedia), just as every human genome is a little bit different. It’s certainly true that we each restrict our intake of words and language, and that helps form our identity, but the point about liberty is that we keep control. So we can expect that illiberal forces in society will seek to control the language and ideas we’re exposed to, and for this to be effective it’s better off if we don’t know about it.

In an article called ‘What if we Occupied Language?‘ H. Samy Alim points out that the Occupy movement has successfully modified the associations of the word ‘occupy’ for Americans so that they no longer think first of Iraq, but think of protest movements instead. The piece goes on to discuss ways of reclaiming language: ‘in the face of such widespread language-based discrimination, Occupy Language can be a critical, progressive linguistic movement that exposes how language is used as a means of social, political and economic control.’

And here’s Eli Pariser talking about how Google and Facebook create invisible ‘filter bubbles’ with algorithms that screen what information we receive by anticipating our wants. He fears that our young internet doesn’t have the ethical checks to make sure we find out what we need as well as what we want.

Literature—you could see where I’m going with this—is a valuable way to keep the gene and words pools of society lively. It’s a seed-bank guarding our stocks of different ideas and perspectives up, and stops us from becoming too much like verbal and ideological clones. There is tension here in how literature serves that duty, though. Over at the New York Review of Books, there were sharp words exchanged between Rita Dove, who defended her anthology of twentieth-century American poetry and Helen Vendler, who reviewed it. Dove’s inclusive anthology picks from a wide range of writers from different backgrounds who all use language in different ways. Vendler rounds on the book for doing not enough justice to the canonical poets, who we can understand are those who exert exquisite control and strength through their language, which later readers can imitate. As Toni Morrison and others point out (see this blog post for a discussion), Vendler’s sort of canon is like a powerful national empire, one which does not necessarily work towards liberty. This is a fundamental difference—so fundamental that Vendler was involved in a similar spat in the 1970s when reviewing another anthology, and is fought over how literature best serves liberty (if we accept the consensus in the U.S. and Europe that the two go together).

Universities and liberal education in general also help a society’s gene pool to stay strong. Here’s a piece by Keith Thomas on how the crisis facing British universities affects everyone from student to professor, as this public function goes unappreciated by a UK government wanting to make a market in higher education. There’s my list of recommended holiday reading links exhausted. This is the type of post that I’d like to be able to read not just next year, but in fifty and five hundred years’ time to see how times have or have not changed.


Medieval Illuminations

My first piece of advice for anyone thinking of studying English literature at university is to remember that the literary canon doesn’t begin with Jane Austen (1775-1817). I read some Andrew Marvell (1621-78), some John Donne (1572-1631), William Shakespeare’s The Merchant of Venice (c. 1596) and his King Lear (1605) at A-Level, but medieval literature was still largely unknown to me, aside from a not particularly fruitful read-through of Geoffrey Chaucer’s The Franklin’s Tale (c. 1390) from the local library. I’m still far from knowledgeable about the whole millennium brought under the single term ‘Middle Ages’ (c.400-1500), but the formative event that kindled my interest was the outstanding exhibition at the Fitzwilliam Museum held during my first term at Cambridge, The Cambridge Illuminations (virtual exhibition still available online).

Another major exhibition of illuminated manuscripts (i.e., handwritten books with decorative images) has just opened at the British Library. It’s called Royal Manuscripts: The Genius of Illumination, and is sumptuous. The display provides a vivid, broad introduction to English elite culture between the ninth and sixteenth centuries through some of the most remarkable books that survive. It’s divided into sections that show royal influence impinging on the creation of these manuscripts: this is a period in which books are a valuable commodity, commissioned and owned by the wealthy. The opening exhibits from Edward IV’s royal library, for example, show royal crests scattered around the page-borders, alongside the fruit, animals and fantastic creatures drawn by the illuminator. The exhibition surveys Christian texts, expressions of royal identity (e.g. genealogical trees), books of instruction and reference, and items with strong links to continental culture.

These manuscripts, all at least 500 years old, are remarkably well-preserved, and it’s valuable to appreciate each illumination in context, on the page and within a book that’s been bound and presented for a particular purpose. The lighting is sometimes too dim and the visitor numbers too great to be able to pause and scrutinize each page, but it’s still very possible to absorb the meticulous detail that went into each illumination. There are many highlights (try browsing those on this page, or purchase the app), but for one example, take the image of God the Creator that’s been used to publicize the exhibition: you can see it from a bus passing the museum, or find it in the shop adorning commemorative tote bags, pin badges, fridge magnets and coffee mugs. It’s only when I left nose-breath marks on the exhibition case, however, that I noticed how the image’s details resonated and expanded with the meaning in the text: angels fill the lapis lazuli sky and the vermilion mandorla (almond-shaped panel), and God’s feet don’t quite touch the earth. Theological and artistic precision are combined.

I didn’t need the audio guide to remind me how much more there is to absorb in each of the 150 manuscripts on display than I could take in during one visit. The exhibition shows a modern library fulfilling its duty to educate the general public by bringing its most valuable material out from the store and into a gallery. The manuscripts are a key treasure in our cultural heritage that open up a vista of intellectual endeavour and royal aspiration from the past.  It also shows the indissoluble relation between literature, theology, history, scholarly learning and artistic achievement in the period. The exhibition is open until 13 March 2012, and the permanent Treasures exhibition and the small display of Michael Katakis‘s photographs are also worth looking out if you visit.


The Home and the World (Ghare-Baire)

It’s easier than it ever has been to find films. Cinemas, television channels, retailers (including specialists like Moviemail), film rental and streaming companies (e.g. Mubi), magazines (like Sight and Sound and Little White Lies), film festivals, degrees and other courses—these are all ways to discover new films. It’s so much simpler than it was forty years ago, when you’d have to wait and hope that a film would come out sometime in the movie theatre.

I’m still waiting for the new Béla Tarr film, The Turin Horse, to come to the big screen in England though. I don’t do pirate movies in principle, and I’d be even less likely to settle for a poor-quality or small-screen version of this movie. I was lucky to watch my first Tarr movie, the sublime Werckmeister Harmonies (2000), on a large screen a couple of years ago. See his short Prologue (to Visions of Europe) to get some sense of his work’s strength: I’ve probably watched it ten times, and it still socks me hard in the gut.

Tarr’s marginalization is one example of how screen culture is choked by commercial pressures, even though there are many new avenues to discover film, and independent cinema is apparently thriving again. Andrei Tarkovsky’s unwavering belief that film should aspire to fine art is not much closer to becoming orthodoxy. There’s much to be said for receiving an education in film and screen culture, as in literature.

The Bengali filmmaker Satyajit Ray would make it high on my list of master directors who don’t appear often on British TV. See Pather Panchali (1955) first, a film about how a boy called Apu struggles to maturies in a poor household in rural Bengal. Recently I watched The Home and the World (1984), based on Rabindranath Tagore‘s novel of the same name. Bimala is a wife who’s encouraged by her husband Nikhil to move outside of the rooms she’s enclosed in, and receive a Western education, learn to sing and read, and become more aware about the world. Nikhil invites his wife to meet Sandip, a hard-liner for Swadeshi, a movement to boycott foreign goods. Nikhil won’t stop the poor traders at the market he runs from selling cheap foreign imports because he knows that they can’t afford to buy local goods. Bimala has to get her bearings rapidly in this political environment, as she is forced to choose between Nikhil’s and Sandip’s values and personalities.

The film is a meditation on practical ethics that recalls my surface-scratching reading of the Bhagavad Gita, and Gandian politics: is it better to pursue principles at all costs, or compromise as situations demand? It’s also informative about Hindu-Muslim tensions, colonialism and female independence, but isn’t in the least bit abstract or beard-stroking.

Ray is a master of producing films that depict people’s relationships and thoughts from their glances, their postures, and how their bodies fill the screen, and in doing so reveal wider implications with absolute clarity. The film is immensely compassionate, humane—and watchable. The Home and the World is available in a box set that also contains Ray’s great adaptation of Ibsen’s Enemy of the People (1989). I’m optimistic his films will still be known, will be better known even, in a hundred years’ time, and studied more widely in academic programmes too.


In the Kitchen

I moved into a temporary room last week in a house with a large kitchen. I’ve had a couple of interesting conversations there with people passing through. One was with a pilgrim who’d just travelled to World Youth Day in Madrid—it sounded like a true pilgrimage, memorable for the modern-day hardships of overnight coach-trips and traipsing round the city in blazing heat. While in Spain, the Pope gave an address to young professors at Spanish universities. Christianity has for centuries pursued truth, goodness and beauty through education, and the current Pope was himself a professor at the University of Bonn. His address was particularly relevant to the British situation when he spoke of the dangers of shackling universities to short-term economic and political ends:

We know that when mere utility and pure pragmatism become the principal criteria, much is lost and the results can be tragic: from the abuses associated with a science which acknowledges no limits beyond itself, to the political totalitarianism which easily arises when one eliminates any higher reference than the mere calculus of power. The authentic idea of the University, on the other hand, is precisely what saves us from this reductionist and curtailed vision of humanity.
In truth, the University has always been, and is always called to be, the “house” where one seeks the truth proper to the human person.

Intrinsic good provides a robust philosophical defense of university education (incorporating sciences and humanities), and not just for people of faith; the philosopher M. M. McCabe spoke on this topic during a recent discussion on ‘The Future of the Humanties’ (she starts speaking at 16.10). Some fly-sheets reprinted during the Cambridge vote of no confidence in the government (which ended in a dead heat), sing a similar tune. One headlined ‘Education is a public good’ states (I’m quoting from page 1132):

The current administration [government] understands universities, essentially, as auxiliaries to commerce. Its notion of higher education is that it is or should be a market; that students should be shoppers in this market; that scholars should be salesmen and saleswomen in it. Students have protested forcefully against this idea of what they are and should be. By declaring, collectively, that education is a public good, not merely a financial asset, we [academics] can repay the public’s trust in us and demonstrate that we continue to deserve it.

The second kitchen conversation was with a pure mathematician who is well-read in world literature and was cooking some pork. Our conversation kept coming back to the problem of literary canons. He was arguing that it’s perfectly valid to defend great literature—Shakespeare, Dante, Milton, writers whose first names I don’t need to write—that clearly come closer to expressing essential human truths. Slicing some green beans, I responded with general liberal arguments about the social construction of canons, the need to discover unrecognized achievement, and that as a Renaissance scholar I’m reluctant to insist that you’re a better person if you read Shakespeare as well as I can.

My friend pointed me to an interview with the American critic Harold Bloom that rails against declining standards in American literature departments due to the mingle-mangle of political niceties: ‘I do not give in to political considerations, however they mask themselves. All this business about gender, social class, sexual orientation and skin pigmentation is nonsense. I’m 81. I’m not prepared to temporise any more. I’ve been prophesying like Jeremiah since 1968, warning the profession that it was destroying itself. And it has.’ He pointed me towards a couple of other bracing reads: Allan Bloom’s Closing of the American Mind (1987) and a polemic by Alain Finkielkraut called The Defeat of the Mind (La Defaite de la Pensée¸ also 1987). I’d not read either of these, but I quickly tracked down the latter. Finkielkraut shakes his fist at a liberal multicultural agenda that dilutes the definition of ‘culture’ from affirming pinnacles of human thought to any recognizable social practice:

In effect the term ‘culture’ now has two meanings. The first asserts the pre-eminence of the life of thought; the second denies this: from everyday gestures to the great creations of the human spirit, is not everything cultural?’ Why should we give pride of place to the latter rather than the former, to the life of thought rather than the art of knitting, or the chewing of betel nuts, or the ancestral custom of dunking one’s buttered toast in the morning cup of coffee?’ So there is a malaise in cultural life. True enough, no one from now on is going to draw his revolver when he hears the word ‘culture’. But there are increasing numbers of people who, when they hear the word ‘thought’, reach for their culture.

Elsewhere he defends Shakespeare’s importance over a pair of boots, and envisions a dystopian scenario in which fanatics (believing in high culture) combat the zombies (brain-dead consumers). I’d agree that multiculturalism has its problems. I’m particularly bothered, as Finkielkraut and others better informed than me are, that it can assign cultural identities to people artificially, and hinder genuine interactions between individuals, all the more so in a world where technologies, trade and travelling bring people into contact with one another. The argument goes that you don’t protect collective identities by defining them as fixed entities—identity must be based on individual freedoms and rights. All the same, I’d counter the dichotomy drawn here between judicious prejudice and mindless tolerance. Respect from diversity doesn’t have to be a pre-agreed pact of non-aggression signed by officials who have precious few everyday interactions that really generate culture. Equality should be thoughtful and lively.

Based on my personal experience, I’d also want to disagree with those who solely defend a literary canon, or rationality as an objective: I’ve learnt a great deal from engaging with others who don’t fit easily into traditions of high culture. Some might object to my drawing the analogy, but there’s a similarity in my defence with an old argument used against Richard Dawkins: I wouldn’t assume that evolution gives me a superior knowledge of natural processes if I met an illiterate forest tribesperson, because that person has just as much real-world experience to draw on as I have, and my sophisticated mental designs don’t necessarily equate to a deeper understanding of reality. My rational idea do have practical benefits, such as providing the aeonautical technology  that allowed me to fly there, but the whole question here is about non-utilitarian forms of knowledge. Time is another good example: I can use a watch to devise an efficient schedule for my life, and make complex calculations about past and future plans, but someone who cannot tell the time, but can accurately tell you what time of day it is from the height of the sun possesses genuine awareness of how the world works. And I see that the same goes for literature too: canonical works have been successfully tested as providing rich insights into life, but this doesn’t mean that they provide our best definitions of what it is to be human, or that I can’t find insights in other books that are less cherished by my immediate society. Political correctness isn’t the only reason to listen for neglected voices.

So how do my two kitchen conversations relate? My argument in the second is against rationality as an objective criterion for greatness, and for holistic appreciation and understanding of the world in the pursuit of truth. Both of these arguments tend towards faith-based belief systems, and both are threatened when materialist or pragmatic concerns dominate an educational environment. A separate institutional factor in play here is that literary studies have become more specialized as more work is done, and there are greater numbers of academics; consequently, literary appreciation and intellectual grandeur have become amateur pursuits somewhat separate to professional work. The literary canon, as my friend quite reasonably saw it, remains a natural home for deep humanist thinking, and from this viewpoint inclusiveness leaches away this transcendental energy. But I read the canon more as a meeting-place where people discuss and contest issues, and is itself mobile. Sensitive, committed, opinionated engagement gives energy to these interactions. Being inclusive helps literature retain its special status as a point of contact between different people, different lives—but such interactions need to be genuine and whole-hearted, not based on a vague sense of correctness.

To complete the circle. The Pope imagined what an ‘authentic teacher’ looks like: ‘Young people need authentic teachers: persons open to the fullness of truth in the various branches of knowledge, persons who listen to and experience in own hearts that interdisciplinary dialogue; persons who, above all, are convinced of our human capacity to advance along the path of truth.’ Such teachers are committed, passionate and humble. They do not accede to relativism—and especially not officially-sanctioned relativism based on artificial sense of inclusiveness—but are willing to relate whole-heartedly with their subject-matter and with their students. There is much to take heed of in these sentiments. A public good of education is, as I see it, to facilitate such direct encounters. The Jewish philosopher and educator Martin Buber is a guiding light on this topic, as on this post in general.

In literature, those works (e.g. Shakespeare’s) which have proven a valuable resource for concentrated engagement between reader and text are likely to still be read and to encourage profound cognitive and emotional engagement. But this doesn’t automatically exclude unexpected discoveries that we can make by corresponding with marginal voices and listening to aspects of reality beyond our reach. A political spin on this is that minorities should not be restricted either from gaining empowerment by studying the canons, or the methods on which the West thrives. Literature develops ‘our human capacity to advance along the path of truth’ by encouraging meaningful relationships that allow us to look outside of those systems—political, economic, institutional—in which we exist, and this is something that can be genuinely liberating.


In Veliko Târnovo

Veliko Târnovo is a former medieval capital of Bulgaria, tucked away in a forested hill region where the iconic Tsarevets Fortress looks out across the Yantra river. Travelling from Sofia to Varna last week, I spent a couple of nights in the town, visited nearby Arbanasi, and stayed at a guesthouse which, by chance, also happened to be an English school (Guesthouse Diel–recommended).

The hostess was extremely friendly, spoke excellent English, and was also a passionate advocate of the benefits of studying literature. She gestured to her heart when talking about the empathy that students should bring to studying Shakespeare or Byron, and spoke of the importance of advanced literary skills in modern society. In Bulgaria as elsewhere though, many students are unresponsive in literature classes and choose degrees that will ensure a decent job rather than learning to interpret classic Bulgarian works like Ivan Vazov’s Under the Yoke.

As heart-warming as this conversation was, I don’t mean to portray it as an ad hoc convention of the East European branch of the Dead Poets Society. Our conversation turned, as such conversations sometimes do, to the indifference about literature among general publics. Why do so few students feel the power of great writing! If only Hollywood would make serious Shakespeare adaptations! Would that Total Wipeout was replaced by ‘An Hour with a Sonnet’ on Saturday nights!

Literature is a fairly niche pursuit: lots of people don’t read much, and not all that many read the ‘classics’ in their spare time. That’s how it’s always been, and that’s pretty much fine. I don’t hear mathematicians complaining that more people don’t spend their time brushing up on calculus at weekends, and I probably would have heard if there was a dearth of people studying black holes or nanotechnology or painting. There is a large groundswell of cultural activity in Britain (think of theatres, museums, festivals, newspapers) and to judge from all the books on sale on street-corners, there is in Bulgaria too. Promoting, say, George Eliot‘s merits to others need not entail pillorying them if they’d rather read science-fiction, or get back to Facebook after listening to you.

It’s also natural that literature specialists advocate what interest them, and hope to spark enthusiasm in others. An education in the arts provides the opportunity, in schools and in universities, for those who are responsive to literature to receive support as they pursue their interest, and for others to have some first-hand experience with their cultural heritage whilst gaining valuable literacy skills. Education helps along the exchange of ideas within invisible global networks of like-minded people. But not everyone will be lit up by literature.


Between Technicolor and Tweed

The Public Value of the Humanities is a new collection of essays commissioned by the Arts and Humanities Research Council. It is edited by the Shakespeare scholar Jonathan Bate, who also wrote the introduction. Bate begins by alluding to the biblical Joseph (he of dreamcoat fame) as a precursor of a ‘secular clerisy’ (i.e. bunch of scholars) who devote their energies to studying culture and making forecasts about the future. He has Samuel Taylor Coleridge in mind here, who described ‘an endowed class, for the cultivation of learning, and for diffusing its results among the community’. Bate is quoting John Stuart Mill writing about Coleridge and Jeremy Bentham, the utilitarian philosopher. Utilitarianism is an ethical theory that measures happiness and benefits in numbers to work out which alternative provides ‘the greatest good for the greatest number’: it’s the end result that matters. When seeking knowledge, a friend of Bentham would ask ‘Is it true?’ and a friend of Coleridge would ask ‘what is the meaning of it?’.

Either Mill or Coleridge or Bate or all three raised the following question: ‘How can society foster those dimensions of human life that Benthamite utilitarianism cannot account for—the ethical, the beautiful, the cohesive force?’ The implicit answer is that we can only appreciate the unquantifiable by protecting a group of individuals—i.e. religious clergy or non-religious scholars—who search out and communicate those truths. This is non-utilitarian because it doesn’t make a fixed contribution to society, but it has a public value in searching out these suprarational unifying truths. There is something to this old argument, though different people will baulk at some point when it comes to giving institutional authorization to an elect group of the bespectacled.

Sandwiched between these thoughts, Bate records the answers he got when he asked some of his academic buddies to come up with an answer to the following question: A cabinet minister explains to you that she doesn’t mind ploughing lots of the budget into medical care or international aid, but she does have a problem subsidizing humanities research and teaching. Why should the state pay for the study of literature, when it wouldn’t contribute to costs of other hobbies like horse-riding? ‘I like riding my horse, but I don’t expect the taxpayer to pay for me to do so’. Bate lists ten defences (from scholars in many different fields) for why humanities are  different from horse-riding:

1. Britain is a major world centre of publishing and intellectual life, and it’s necessary to support the humanities to sustain that reputation.

2. Humanities subjects foster critical thinking.

3. History can help improve global security by reminding us, and policy-makers in particular, about the lessons of the past.

4. ‘Bibliotherapy’: books and the arts make a genuine contribution to public health.

5. If the horse-rider was of an international standard, then it’d seem far more reasonable to provide public support. In this regard univerisities, like sport, are a matter of national prestige and so deserve public support (cf point 1).

6. The formation of a ‘cultural identity’ benefits from analytical and historical perspectives.

7. The humanities help sustain cultural heritage and cultural value.

8. An academic discipline aren’t about private hobbies but the public good: research is about disinterested endeavour that helps us understand ourselves and each other.

9. Just because research is driven by curiosity, it doesn’t mean it’s a hobby.

10. It promotes cultural exchange and understanding between different traditions.

A French reader of this blog explained to me the other day that he found it fairly ‘utilitarian’, and that in France it’s more readily assumed that the arts should be promoted for their own sake—’l’art pour l’art.’ The list above tends to emphasize the public benefit of the humanities: what tax-payers get out for putting money in (1, 3, 4, 5, 6, 7, 10). The other items (2, 8, 9) are more purely intellectual, suggesting ways that the humanities contribute to understanding the world. Two common features of academic disciplines in most universities are that they offer expertise, and that they contribute to society. Conversations, teaching, lectures, publication and similar activities are the ways that expertise spreads. A ‘secular clerisy’, a unit of authorized experts on human culture dressed in technicolor tweed, might have its supporters (Matthew Arnold, F.R. Leavis and their followers), but would also rile many people with its exclusivity.

A larger issue here is the nature of the vital relationship between gaining expertise and diffusing it to others–the existence of a community of learning, and its relationship to those outside.  An important starting point is the attitude scholars take: research carried out within and for the benefit of society will have a public value, often the more powerful and sustained for not being created to be shouted about. The basic point to emerge from all this is that one function of the humanities is to examine and uphold non-utilitarian aspects of human activity (e.g., ones without a defined economic benefit), and prompt wider society to think about them too.