Looking for Hollow Faces

A philosophical opinion piece called ‘Do Thrifty Minds Make Better Brains?’ by Andy Clark, a professor of logic and metaphysics at Edinburgh, relates how our thrifty minds conserve energy and activity by being ‘engines of prediction’. He draws on research in neuroscience to argue that we amass a bank of stored images that replace (and sometimes cancel out) new sensory data about phenomena we’ve seen before. The mind uses its existing knowledge to avoid having to process everything that confronts us as though new; instead, the brain registers anomalies from the expectations it has created: ‘What is marked and passed forward in the brain’s flow of processing are the divergences from predicted states: divergences that may be used to demand more information at those very specific points, or to guide remedial action.’

Even at this point, Clark’s argument rings many literary bells for me (e.g. George Eliot (such as the squirrel’s heart-beat line I’ve mentioned before); or T.S. Eliot’s ‘Humankind cannot bear very much reality’, given an explicitly Christian reading here—there are religious ideas lurking near these arguments). Clark also alludes to possible literary applications when he meditates on the idea that perception and imagination are linked activities:

[P]erception (at least of this stripe) now looks to be deeply linked to something not unlike imagination. For insofar as a creature can indeed predict its own sensory inputs from the “top down,” [i.e. is knowledge-driven] such a creature is well positioned to engage in familiar (though perhaps otherwise deeply puzzling) activities like dreaming and some kind of free-floating imagining. These would occur when the constraining sensory input is switched off, by closing down the sensors, leaving the system free to be driven purely from the top down. We should not suppose that all creatures deploying this strategy can engage in the kinds of self-conscious deliberate imagining that we do. Self-conscious deliberate imagining may well require substantial additional innovations, like the use of language as a means of self-cuing. But where we find perception working in this way, we may expect an interior mental life of a fairly rich stripe, replete with dreams and free-floating episodes of mental imagery.

Clark uses the example of the hollow-face illusion, which is much more easily appreciated by watching the video attached to his article than by explanation. In essence, Clark takes this famous illusion (it turned up in the Royal Institute Christmas Lectures this year, with Einstein’s head instead of Chaplin’s) as a good example of how the mind’s activity affects our perception: we always see the rounded face because the idea of a hollow face is so foreign to us that we reject the incoming sensory data, and plump for a fictional, illusory perception.

The article doesn’t actually specify any view about what literature or the arts involve, but I do find a set of productively disagreeable implications (which I stress are not made in the article) that could grow out of it. If you were to define an artist as someone with ‘an interior mental life of a fairly rich stripe, replete with dreams and free-floating episodes of mental imagery’, in short someone wildly imaginative, then you might be led to think that arty types love to play with fictions and deal with counter-factuals. In this view the artist toys with reality and lets the mind run free. Clark’s line about ‘use of language as a means of self-cuing’ could imply that poetry is a literary form that encourages the mind to engage in such creative, associative play. The creative mind makes its own false rounded faces and indulges its fantasties.

This sounds reasonable enough, and there may be something in it. But I also disagree that this provides anything like an approximation of what artistic contemplation and creation may accomplish. For a start, this state only occurs when ‘the constraining sensory input is switched off, by closing down the sensors’, so you can forget any naturalistic observation, and this also shuts down any social engagement in the relevant art: Clark refers elsewhere to how our imagination stores prejudices. In fact, I think this model of artistic creation as unplugged from reality and left to engage in play is positively immoral because it would define artistic creation as the reorganization of false certainties, severed from truth, and unwilling to participate in the world.

When I watch the hollow-face illusion, I try to convince my mind to discard its illusion and to see the hollow face that’s really there. I do this in vain– but I don’t want to settle for the illusion. Similarly, I would always pick the blue pill in the world of the Matrix. Likewise, many great artists are intensely curious and inquisitive people who also don’t want to accept fictions, but want to use their imagination to re-route the mind so that it can see what’s there more clearly. There are many ways to try to see the hollow face, such as to observe it as closely as possible (realism), or to realize that the mask you see has a deeper meaning, i.e. a hollow face (symbolism).

I’ve been reading Wallace Stevens and his early critics recently, and there is a great deal of pertinent material to draw on here. Stevens has been seen as the ‘poet of consciousness’ par excellence. Here is verse about how a singer who ‘sang beyond the genius of the sea’ fashions her world through her singing:

It was her voice that made
The sky acutest at its vanishing.
She measured to the hour its solitude.
She was the single artificer of the world
In which she sang. And when she sang, the sea,
Whatever self it had, became the self
That was her song, for she was the maker. Then we,
As we beheld her striding there alone,
Knew that there never was a world for her
Except the one she sang and, singing, made. (The Idea of Order at Key West)

The singer’s voice creates her world, parallel to the world as it is, but still a beautiful fiction. The actual sea is as inaccessible as the hollow face. Stevens’ poem may seem to go against my argument, because he explores the impossibility of seeing or singing the sea as it is. But his poetry can be read as an exploration of how we reach and deal with this limitations, as human beings. He writes elsewhere that ‘I thought we had reached a point at which we could no longer believe in anything unless we recognized that it was a fiction [….] there are fictions that are extensions of reality [….] Heaven is an extension of reality’ (letter to Henry Church, 8 December 1942) and that ‘[poetic] truth is an agreement with reality, brought about by the imagination of a man strongly disposed to be influenced by his imagination, which he believes, for a time, to be true’ (‘Figure of the Youth as Virile Poet’). These are the serious thoughts of a man engaged in the world, not someone withdrawing to a domain of happy fancy.

For Stevens here the imagination is an instrument used to reach towards truth once we know that it is unreachable: there are necessary fictions. There is mystery on the land and in the seas. In his poetry Stevens uses language to test out these limitations, and to discover the point where the mind stops us from seeing more clearly. I doubt Stevens could have seen the hollow face either, but his poetry doesn’t just mess around with versions of the illusory rounded face either—his poetry is not divorced from the understanding, despite Yvor Winters’ view that Stevens gives us ‘the most perfect laboratory of hedonism to be found in literature [….] his ideas have remained essentially unchanged for more than a quarter of a century’. His poetry, and other poetry, is a different type of laboratory: once conducting advanced experiments in how we build our sense of reality, aware that any such investigations cannot ignore the fallibility of the investigator. The imagination can do more than juggle prejudices and preconceptions into new forms: it can help us to dabble in reality and try to see hollow faces.


Literature as Seed Bank

I visited the Wellcome Collection last week and browsed through the Code of Life. A wall was filled with shelves of the human genome, mapped and printed as sequences of letters in many volumes for each chromosome. Here’s a tiny extract from Chromosome Six:

TATTTTTTAAAATTGAATTCAATAATATATTAAAAAGGATGATATAACATGATCATAAAA
GTTTATGCCAGGAATGGAAGGCATGTTTAACATGCAAAAAATCAATGTGATTCCACATCT
TAACAGAATACAAAAGAAAAATTATGTAATTATGTAAATGGATGCAGAAAAAGGCATTTG
CTCATTCATGATAAAAAGTCCTAGAAAACTAGGAATAAAAAGGAATTACCTGATAAGGTG
TGTCCATGAAAACCAACAACTGAAATTTTCAATTTTGGGTGGGGGAGGGGGGCGGGCATT
TTACTTTCTCCATAAAACTATTAAATTATCTAATGTGAAAGTGGAATTCAGTGAAGAAAT
GTTCCCTACTGCAAAAATACAAAATGCTGGACATTCTGTGAACAGTTTCTATGCATTCTA
TATAAATGAAACTATTAACTATATAATACATTTATTGAAAAAAGAAGATGGCCTTCTTTT

Together the letters correspond to an individual human being, and no two people have the same sequences of letters (unless you’re identical twins?–I hope my novice biological knowledge is holding up here).It’s important for the human species that the population retains the widest possible body of genes to encourage variation and adaptation so that the species stays strong. We need a large gene pool.

Gene pools are connected to our idea of liberty. John Stuart Mill’s classic treatise On Liberty was published in 1859, the same year as Charles Darwin’s Origin of Species. Mill ‘insists on freedom of thought as the only effective means for keeping the gene pool of ideas well-stocked and ready to generate valuable original notions that can improve the general sum of happiness’ (see the article by Scott Rosenberg that this quotation comes from for more). Liberty allows societies to keep healthy in future generations, and not succumb to the intellectual incest of authoritarian regimes, censorship or other forms of ideological control.

One aspect of liberty is to keep our gene pool of ideas splashy by allowing lots of different languages, words and phrases to co-exist. There isn’t a single Book of Knowledge (no, not even Wikipedia), just as every human genome is a little bit different. It’s certainly true that we each restrict our intake of words and language, and that helps form our identity, but the point about liberty is that we keep control. So we can expect that illiberal forces in society will seek to control the language and ideas we’re exposed to, and for this to be effective it’s better off if we don’t know about it.

In an article called ‘What if we Occupied Language?‘ H. Samy Alim points out that the Occupy movement has successfully modified the associations of the word ‘occupy’ for Americans so that they no longer think first of Iraq, but think of protest movements instead. The piece goes on to discuss ways of reclaiming language: ‘in the face of such widespread language-based discrimination, Occupy Language can be a critical, progressive linguistic movement that exposes how language is used as a means of social, political and economic control.’

And here’s Eli Pariser talking about how Google and Facebook create invisible ‘filter bubbles’ with algorithms that screen what information we receive by anticipating our wants. He fears that our young internet doesn’t have the ethical checks to make sure we find out what we need as well as what we want.

Literature—you could see where I’m going with this—is a valuable way to keep the gene and words pools of society lively. It’s a seed-bank guarding our stocks of different ideas and perspectives up, and stops us from becoming too much like verbal and ideological clones. There is tension here in how literature serves that duty, though. Over at the New York Review of Books, there were sharp words exchanged between Rita Dove, who defended her anthology of twentieth-century American poetry and Helen Vendler, who reviewed it. Dove’s inclusive anthology picks from a wide range of writers from different backgrounds who all use language in different ways. Vendler rounds on the book for doing not enough justice to the canonical poets, who we can understand are those who exert exquisite control and strength through their language, which later readers can imitate. As Toni Morrison and others point out (see this blog post for a discussion), Vendler’s sort of canon is like a powerful national empire, one which does not necessarily work towards liberty. This is a fundamental difference—so fundamental that Vendler was involved in a similar spat in the 1970s when reviewing another anthology, and is fought over how literature best serves liberty (if we accept the consensus in the U.S. and Europe that the two go together).

Universities and liberal education in general also help a society’s gene pool to stay strong. Here’s a piece by Keith Thomas on how the crisis facing British universities affects everyone from student to professor, as this public function goes unappreciated by a UK government wanting to make a market in higher education. There’s my list of recommended holiday reading links exhausted. This is the type of post that I’d like to be able to read not just next year, but in fifty and five hundred years’ time to see how times have or have not changed.


Poetry by Heart

The only time that I’ve been encouraged to memorize poetry was for an individual verse speaking competition at secondary school. I learnt short poems like William Blake’s ‘Poison Tree‘ and Wilfred Owen’s ‘Anthem for Doomed Youth‘ by heart, and found it more enjoyable than daunting. I’ve not thought much about memorizing poetry since, except that it feels a very traditional way to study poetry: I was learning poems as an extra-curricular activity, not in an English lesson.

Recently I’ve come to realize that it’s an extremely valuable activity if practiced properly. I don’t much care to become a walking minstrel, or to use it to improve mental agility, or to chuck away my mp3 player or the smartphone I don’t own because I have the music of poetry running round my head. I’m not interested in it for the same reason that the author of this essay called ‘Got Poetry?‘ is. No, memorizing poetry fascinates me because it forces you to meet a poem on its own terms: to hear it well, read it several times, understand its structure, internalize its rhythms, and empathize with the speaker.

I’ve occasionally said, somewhat flippantly, that my Cambridge English degree taught me everything apart from how to read at the right speed. I can spend an hour poring over a single poem, and I can leaf through whole books to extract just the quotation I think I want. But it’s only by pausing to absorb poems that a poem begins to radiate before me, and this sensitivity is trained by having it echo in my skull. Memorization helps me produce those conditions, even if I don’t spend long enough with it to be able to recite it a few days later.

This old technique is also teaching me how poetry is written. Great poets have usually read, studied and imitated previous great poets. By insisting on originality and resisting disciplined study of poetry’s music, I believe—and my conservatism surprises me—we miss out on how humans developed advanced language skills. We learn language through imitating our parents, and perhaps we learn poetry through imitating our literary forebears.

Memory is particularly associated with poetry, rather than any other form of writing. Its repetitions and subtle connections make it easier to memorize. Indeed, one theory goes that poetry originated as mnemonic writing: its patterns helped people to remember lists, stories, religious doctrine and other information. Research has shown that music and memory are associated.

You gain something by learning one poem that you don’t by casting eyes over six poems by the same poet. The memory arts activate something in the mind. Memorization may seem daunting or simply antiquated given modern-day technological advances, but even in small amounts I find it cultivates and strengthens my mental circuitry. Poets.org suggests some starting points if you feel inspired to memorize a poem.


Thinking about Teapots

I spoke at a humanities outreach day for Year 9 students in Oxford last week. My question was ‘How is English different from Maths?’, and my answer was that Maths is more about learning systems of thought that make things seem simpler, whereas in English you more often learn to ask new questions about the world, and so make things seem more complicated. I also argued that in humanities subjects you always deal with human culture and the world around us, but in maths you start with abstract ideas, then apply them to particular situations. Yes, there are lots of interesting exceptions here—but I stuck to making this point to the audience with three examples.

First, I showed that learning English requires more than mastering rules and methods. Spelling bees test this kind of knowledge, but spelling champs don’t necessarily make amazing English language and literature students. It takes more life experience and exposure to culture to thrive at English, and I suggested that this is why you hear of Maths prodigies but not English prodigies. Point Two was an exercise in appreciating historicity (historical quality or character). I showed the audience a series of BBC homepages from 2011, 2008, 2004, 2001, 1997, and finally the first BBC homepage from 21st December 1996. My aim here was to provoke questions about how a webpage is specific to one moment in time. What methods are being used to attract our attention? How different will the webpage be in fifteen years’ time? Would someone looking at the website in 500 years’ time conclude that we’re weather obsessed given that the central box on the current homepage (i.e. in July 2011) shows the weather forecast—and would our futuristic friend be correct?

Then I looked at different ways to think about teapots. I showed the students the following complete poem by the American poet Samuel Menashe (the recordings on the linked page are great):

A pot poured out
Fulfills its spout.

With a little bit of critical jiggery-pokery (e.g. note that the letters ‘p-o-t’ appear three times), I suggested that the poem makes you think again about something so simple as a teapot, about its existence, and what is fulfilling about being ‘ful-filled’. The physical object of the teapot is essential to the poem, just as in English studies generally you can’t get away from lived experience, whether it’s society, the media, different cultures or what’s on your breakfast table. These thoughts are expressed using extremely controlled use of language (if you think this poem is absurdly simple, try writing another). In its odd little way the poem challenges common sense.

I drew a contrast with a mathematician who could tell you about the teapot’s volume or rate of cooling by applying analytical techniques to the object. And I asked a quick-witted philosopher who gave a presentation later about how a philosopher might think about a teapot. In reply he asked us to imagine a moderately warm teapot and two people, one of whom has lived his or her entire life in the Arctic. The teapot would seem very hot to that person, but merely warm to someone else. So does this mean that hot and cold don’t really exist? The teapot was a good example of the different types of question that each subject raises. Maths and science can quantify and suggest practical improvements to how a teapot is used; philosophy asks basic questions about what we do and don’t know, and English…well, English shows you how different people see and think about the teapot, which makes you appreciate how different people look at the world, and use language to express that viewpoint, and so English challenges your established patterns of thinking, and helps you appreciate language, culture and the world around you with fresh eyes and ears.


The –––– Teller

Had but the Tale a –––– Teller –
All the Boys would come –

What’s the missing word? The couplet is taken from an Emily Dickinson poem (‘The Bible is an antique Volume’, Johnson 1545; Franklin 1577] that Helen Vendler discusses in her 2010 book Dickinson: Selected Poems and Commentaries(pp. 491-95).

Vendler has seen a draft of the poem, and writes that Dickinson was dissatisfied with her first choice, ‘thrilling’. So the poet launched ‘into a verbal extravaganza of thirteen different alternative adjectives, each a possible characterization of the Teller’: ‘typic’, ‘hearty’, ‘bonnie’, ‘breathless’, ‘spacious’, ‘tropic’, ‘warbling’, ‘ardent’, ‘friendly’, ‘magic’, ‘pungent’, ‘winning’ and ‘mellow’.

According to Samuel Taylor Coleridge ‘prose = words in their best order; poetry = the best words in their best order.’ For Coleridge a poem was a composition in which changing even a single word would alter its meaning. Reading closely requires an inner ear fine-tuned to hear quiet sounds and whispers, subtle distinctions and emphases. And this example from Dickinson’s poetry shows someone who is able to suspend judgement, and wait patiently until exactly the right word comes to mind. The process reveals an acutely sensitive, fertile mind.

One reason to study literature is to train the mind to read and listen in newly attentive ways. Poetry demands concentration. Equally, poetry is not just something to prod at and dissect dispassionately. Here’s Philip Larkin from a Paris Review interview:

‘Oh, for Christ’s sake, one doesn’t study poets! You read them, and think, That’s marvelous, how is it done, could I do it? and that’s how you learn.’

 

(Dickinson selected the word ‘warbling’: ‘Had but the Tale a warbling Teller – | All the Boys would come -‘)


Dove Cottage

Dove Cottage is where William Wordsworth lived for eight years and wrote some of his most celebrated poetry. I went on a guided tour there during a trip to the Lake District last week, and was shown where William, Mary (his wife) and Dorothy (his journal-writing sister) lived, ate, slept and brought up children; in Wordsworth’s garden I sat and enjoyed the same views over Grasmere that he did (with an additional set of grey houses and some diggers); in the adjoining Wordsworth Museum I viewed manuscripts of The Prelude through glass (see the Digital Wordsworth resource for some examples); in the Gift Shop I could choose from a library of Wordsworth editions to take home.

I told a computerized visitor survey that my visit was ‘for leisure’. Nonetheless, the day-trip will inevitably affect how I read Wordsworth’s verse in future—to a point. I know more about the conditions in which Wordsworth wrote, but this understanding doesn’t make me any more sensitive to the thematic resonances of his poetry. His work is, among other things, about landscape, nature and the imagination: Wordsworth wasn’t completing a commission for the Lake District tourist board (though he did also write a guide to the Lakes). The knowledge I gained about Wordsworth’s poetry was valuable, but inessential.

You might reasonably ask, though, whether reading Wordsworth’s poetry is primarily a leisure activity, and therefore not something that needs to be studied in school. In other words: read Wordsworth if that’s your idea of fun, but don’t confuse it with proper work or study. Dove Cottage does indeed perform a variety of educational and cultural duties: in addition to preserving a Grade I listed building and promoting Wordsworth’s works, it is a centre for contemporary poetry and does lots of outreach work. Most visitors to Dove Cottage travel there, as I did, for a stimulating leisure activity. You might also wonder why we need professional scholars to devote their energies to Wordsworth’s poetry, when the Cottage and Museum’s curators are well-placed to protect Wordsworth’s legacy.

The soft answer to these questions (and a common one) is that Wordsworth forms part of the British cultural consciousness, and so wouldn’t it be a terrible thing if the next generation didn’t know ‘Daffodils‘? An alternative, stronger answer is that studying Wordsworth’s works, rather than just reading them, does not just transmit a time-worn appreciation of his poetry and its literary historical importance, but challenges us to respond anew to the poet, and push ourselves to read more closely and intently. Scholars are at the vanguard of this effort, since they expose blind-spots in previous interpretations, explore new connections and contextual information, and bring Wordsworth studies into line with the latest methodological developments.

The difference between studying and reading can be measured in the time and attention given to the activity. The additional concentration required when studying a poet (whether a researcher or GCSE student) is qualitatively different from having an amateur interest, and this is why it’s important to support this additional expenditure of energy in classrooms and research libraries.

I’d recommend a visit to Dove Cottage without hesitation. Beyond being tourist attraction, the Cottage has links with schools and professional scholars that are important to fulfilling its mission. The Cottage is a precious supplement to full-time education, but it is a different type of institution. Recreational activities—visiting a museum, watching a documentary or reading poetry before going to bed—are nourishing and important. But these pastimes have less intensity and mind-strengthening capacity than being made to pore over literature. Dove Cottage sparks enthusiasm to immerse yourself in the Wordsworths’ poetry and journals, but you don’t need to visit in order to appreciate or engage deeply with them.


Geoffrey Hill, Professor of Poetry Lecture (8th March)

The second Professor of Poetry lecture was given in the Oxford Exam Schools on Tuesday by Geoffrey Hill. Hill is a formidable poet and critic, known for pushing hard against the limits of the English language. He has a prophetic air—helped along by his white waterfall of a beard—in his public utterances. His inaugural lecture, for example, drew a connection between skimming and scamming: giving a cursory glance to the world or to a poem leaves you susceptible to political fast-talking and deception.

In Lecture Two Hill said that he wishes to focus on poetry from the period 1520 to 1720 in his lectures (all fourteen remaining ones, was my impression). As a student of exactly this period, this was all very gratifying, as were admiring references to Thomas Wyatt, John Donne and especially William Shakespeare’s sonnets (a guide to the ‘intelligence of the age’). Hill spent around twenty minutes talking through a lyric poem by the lesser-known Cavalier poet, John Suckling. The perceptiveness of his reading aside, Hill’s analysis was intended to show how poetry from this period is invariably well-crafted, even when written by John Suckling. The attention to conceits, paradoxes, shifts of meaning, ambiguities, versification, rhyming, syntax and so forth is all there. This sensitivity makes the poetry more difficult to read, but this is entirely positive. It’s like preferring chewy wholemeal bread to unfilling white.

He ended by referring to a recent trip to HMV in which he bought the new PJ Harvey album, which apparently wasn’t all that displeasing (he was less impressed with The Streets’ ability to rhyme—’knitten’ and ‘thicken’ didn’t impress). The appeal is less surprising given that her record’s called ‘Let England Shake’. His lecture enforced the value of canonical English poetry to create tough, alert readers who are responsive to today’s political and cultural situation. He also suggested that young poets should look to the masters, or even imitators of the masters, and try to recover their technical innovations. You may not agree that England is a stagnating morass, and you may not think that Renaissance lyric poetry is where all the literary wholemeal bread is. But there’s a valuable reminder about the importance of literary study here, and Hill hopes that his lectures convey a ‘blank intransigence’ (Hill quoting from A.D. Nuttall‘s Overheard by God) about what he believes in.

An example. Hill pretended to throttle himself to convey the strength he felt in the language in line 8 of this Thomas Wyatt lyric. It’s about the perils of court-life and fame:

1   Stond who so list vpon the Slipper toppe
2   Of courtes estates, and lett me heare reioyce;
3   And vse me quyet without lett or stoppe,
4   Vnknowen in courte, that hath suche brackish ioyes.
5   In hidden place, so lett my dayes forthe passe,
6   That when my yeares be done, withouten noyse,
7   I may dye aged after the common trace.
8   For hym death greep’the right hard by the croppe
9   That is moche knowen of other, and of him self alas,
10   Doth dye vnknowen, dazed with dreadfull face.

(Thomas Wyatt, Poem CCXL [Stond who so list vpon the Slipper toppe], text from Literature Online)