Literature as Seed Bank

I visited the Wellcome Collection last week and browsed through the Code of Life. A wall was filled with shelves of the human genome, mapped and printed as sequences of letters in many volumes for each chromosome. Here’s a tiny extract from Chromosome Six:

TATTTTTTAAAATTGAATTCAATAATATATTAAAAAGGATGATATAACATGATCATAAAA
GTTTATGCCAGGAATGGAAGGCATGTTTAACATGCAAAAAATCAATGTGATTCCACATCT
TAACAGAATACAAAAGAAAAATTATGTAATTATGTAAATGGATGCAGAAAAAGGCATTTG
CTCATTCATGATAAAAAGTCCTAGAAAACTAGGAATAAAAAGGAATTACCTGATAAGGTG
TGTCCATGAAAACCAACAACTGAAATTTTCAATTTTGGGTGGGGGAGGGGGGCGGGCATT
TTACTTTCTCCATAAAACTATTAAATTATCTAATGTGAAAGTGGAATTCAGTGAAGAAAT
GTTCCCTACTGCAAAAATACAAAATGCTGGACATTCTGTGAACAGTTTCTATGCATTCTA
TATAAATGAAACTATTAACTATATAATACATTTATTGAAAAAAGAAGATGGCCTTCTTTT

Together the letters correspond to an individual human being, and no two people have the same sequences of letters (unless you’re identical twins?–I hope my novice biological knowledge is holding up here).It’s important for the human species that the population retains the widest possible body of genes to encourage variation and adaptation so that the species stays strong. We need a large gene pool.

Gene pools are connected to our idea of liberty. John Stuart Mill’s classic treatise On Liberty was published in 1859, the same year as Charles Darwin’s Origin of Species. Mill ‘insists on freedom of thought as the only effective means for keeping the gene pool of ideas well-stocked and ready to generate valuable original notions that can improve the general sum of happiness’ (see the article by Scott Rosenberg that this quotation comes from for more). Liberty allows societies to keep healthy in future generations, and not succumb to the intellectual incest of authoritarian regimes, censorship or other forms of ideological control.

One aspect of liberty is to keep our gene pool of ideas splashy by allowing lots of different languages, words and phrases to co-exist. There isn’t a single Book of Knowledge (no, not even Wikipedia), just as every human genome is a little bit different. It’s certainly true that we each restrict our intake of words and language, and that helps form our identity, but the point about liberty is that we keep control. So we can expect that illiberal forces in society will seek to control the language and ideas we’re exposed to, and for this to be effective it’s better off if we don’t know about it.

In an article called ‘What if we Occupied Language?‘ H. Samy Alim points out that the Occupy movement has successfully modified the associations of the word ‘occupy’ for Americans so that they no longer think first of Iraq, but think of protest movements instead. The piece goes on to discuss ways of reclaiming language: ‘in the face of such widespread language-based discrimination, Occupy Language can be a critical, progressive linguistic movement that exposes how language is used as a means of social, political and economic control.’

And here’s Eli Pariser talking about how Google and Facebook create invisible ‘filter bubbles’ with algorithms that screen what information we receive by anticipating our wants. He fears that our young internet doesn’t have the ethical checks to make sure we find out what we need as well as what we want.

Literature—you could see where I’m going with this—is a valuable way to keep the gene and words pools of society lively. It’s a seed-bank guarding our stocks of different ideas and perspectives up, and stops us from becoming too much like verbal and ideological clones. There is tension here in how literature serves that duty, though. Over at the New York Review of Books, there were sharp words exchanged between Rita Dove, who defended her anthology of twentieth-century American poetry and Helen Vendler, who reviewed it. Dove’s inclusive anthology picks from a wide range of writers from different backgrounds who all use language in different ways. Vendler rounds on the book for doing not enough justice to the canonical poets, who we can understand are those who exert exquisite control and strength through their language, which later readers can imitate. As Toni Morrison and others point out (see this blog post for a discussion), Vendler’s sort of canon is like a powerful national empire, one which does not necessarily work towards liberty. This is a fundamental difference—so fundamental that Vendler was involved in a similar spat in the 1970s when reviewing another anthology, and is fought over how literature best serves liberty (if we accept the consensus in the U.S. and Europe that the two go together).

Universities and liberal education in general also help a society’s gene pool to stay strong. Here’s a piece by Keith Thomas on how the crisis facing British universities affects everyone from student to professor, as this public function goes unappreciated by a UK government wanting to make a market in higher education. There’s my list of recommended holiday reading links exhausted. This is the type of post that I’d like to be able to read not just next year, but in fifty and five hundred years’ time to see how times have or have not changed.


N-Words

A friend in America asked me last week what I made of the new edition of Mark Twain’s Huckleberry
Finn that takes out the 200 occurrences of the word ‘nigger’ and replaces them with ‘slave’. The book editor’s claimed that the censorship would encourage the book back onto school curricula from which it has apparently been edged off in nervous embarrassment. Sarah Churchill, a lecturer at the University of East Anglia, specifically countered this argument in The Guardian back in January with the sensible comment that ‘the whole point of literature is to expose us to different ideas and different eras, and they won’t always be nice and benign’.

Churchill is right, as I see it, to insist that literary studies involve confronting the textual remains of the past. Pretending that Twain didn’t use the word inhibits sensitive analysis of how language shapes Twain’s treatment of race in the novel, and how it has acquired its highly offensive present-day connotations. A lesson on Huckleberry Finn could bring to light how the word fits into Huck’s discourse, what views about race its use promotes, whether they were sensational at the time, and how acceptable or not they are today. The text deserves to be bowdlerized only in those cases where the target readership or audience is incapable of such analysis; amending the book’s language makes sense for a pre-school TV adaptation. But on the whole, passing over such an awkward issue risks magnifying the misunderstanding. In this case, the discomfort makes it an even more pressing topic to discuss. It clarifies when use of the word deserves to be condemned, but a censored edition of Huck Finn prevents such dialogue. It encourages the conditions for the scary recent controversies about the word ‘niggardly’. Scarier still is that such discussion does impose a racial connotation to the word that it never originally had: I doubt any US politician has used the word in public recently.

This new edition of Huckleberry Finn reflects one viewpoint in the contemporary States. In fifty years’ time it could be taken up by scholars as evidence of cultural consciousness in early twenty-first-century North America (though making generalizations from one book would be rash). Editions of this ‘Great American Novel’ are affected by the editor’s conception of what a ‘Great America’ speaks like. The word history of ‘niggardly’ now tells its own story of racial sensitivity. Language is context-dependent, and literary studies help us to study text and context together. We learn about English language and its interactions with culture. Such study makes us more aware of the forces that exert themselves on our tongues, and gives us the mental strength to make new sounds.